bio-ecological-genomics-edna-metabarcoding

Version Compatibility

Reference examples tested with: DADA2 1.30+, cutadapt 4.4+

Before using code patterns, verify installed versions match. If versions differ:

• R: packageVersion('<pkg>') then ?function_name to verify parameters
• CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

eDNA Metabarcoding

"Process my eDNA samples to identify species" → Transform raw amplicon reads (COI, 12S, rbcL, ITS) into species occurrence tables through primer removal, denoising (DADA2 ASVs), taxonomy assignment against reference databases (BOLD, MIDORI2), and contamination filtering with decontam.

• CLI: cutadapt for primer removal, obi (OBITools3) for paired-end assembly
• R: dada2::filterAndTrim() → dada() → assignTaxonomy() for ASV pipeline

Processes environmental DNA amplicon reads into species occurrence tables with taxonomy assignment, contamination filtering, and occupancy modeling.

Primer Removal with Cutadapt

Goal: Remove amplicon primers from paired-end eDNA reads while discarding untrimmed read pairs.

Approach: Use cutadapt linked adapter trimming with marker-specific primer sequences and minimum overlap enforcement.

Linked adapter trimming removes primer pairs while discarding reads lacking primers:

# COI primers (mlCOIintF / jgHCO2198)
cutadapt -g 'GGWACWGGWTGAACWGTWTAYCCYCC;min_overlap=20' \
         -G 'TAIACYTCIGGRTGICCRAARAAYCA;min_overlap=20' \
         --discard-untrimmed --pair-filter=any \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         raw_R1.fastq.gz raw_R2.fastq.gz

# 12S MiFish-U primers
cutadapt -g 'GTCGGTAAAACTCGTGCCAGC;min_overlap=18' \
         -G 'CATAGTGGGGTATCTAATCCCAGTTTG;min_overlap=18' \
         --discard-untrimmed --pair-filter=any \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         raw_R1.fastq.gz raw_R2.fastq.gz

# ITS primers (ITS1F / ITS2)
cutadapt -g 'CTTGGTCATTTAGAGGAAGTAA;min_overlap=18' \
         -G 'GCTGCGTTCTTCATCGATGC;min_overlap=18' \
         --discard-untrimmed --pair-filter=any \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         raw_R1.fastq.gz raw_R2.fastq.gz