Getting it into your agent
One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.
npx agentmods add skills/thesecondfox/skill/bio-primer-design-primer-validationnpx skills add thesecondfox/skill --skill bio-primer-design-primer-validationgit clone --depth 1 https://github.com/thesecondfox/skillWrote this? Show the measurements
A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.
[](https://agentmods.dev/skills/thesecondfox/skill/bio-primer-design-primer-validation)<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-primer-design-primer-validation"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-primer-design-primer-validation.svg" alt="Measured on agentmods" height="20"></a>What it costs to keep this loaded
Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.
| Model | Per session | Once invoked |
|---|---|---|
| Fable 5.1 | $0.00057 | $0.03338 |
| Opus 5 | $0.00028 | $0.01669 |
| Sonnet 5 | $0.00011 | $0.00668 |
| Haiku 4.5 | $0.00006 | $0.00334 |
Grade A, and why
bio-primer-design-primer-validation scanned grade A with 0 findings against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 2d ago.
A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.
Nothing flagged
None of the 26 patterns this scan looks for appear in this file: no shell pipes, no recursive deletes, no credential paths, no hidden text, no instruction-override or anti-refusal phrasing, no agent-config snooping. That is not a guarantee, it is the absence of the things that are checkable.
How it starts
The opening of the file, as written. The whole thing — 338 lines — stays where its author put it; the contents beside it link to each section on GitHub.
Version Compatibility
Reference examples tested with: pandas 2.2+, primer3-py 2.0+
Before using code patterns, verify installed versions match. If versions differ:
- Python:
pip show <package>thenhelp(module.function)to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Primer Validation
Check primers for secondary structures, dimers, and other issues using primer3-py.
"Validate a primer pair" → Check for hairpins, self-dimers, heterodimers, and 3' stability using thermodynamic calculations.
- Python:
primer3.calc_hairpin(),primer3.calc_homodimer(),primer3.calc_heterodimer()(primer3-py)
Required Imports
import primer3
Check Hairpin Formation
primer = 'ATGCGATCGATCGATCGATC'
hairpin = primer3.calc_hairpin(primer)
print(f'Hairpin Tm: {hairpin.tm:.1f}C')
print(f'Hairpin dG: {hairpin.dg:.1f} cal/mol')
print(f'Hairpin dH: {hairpin.dh:.1f} cal/mol')
print(f'Hairpin dS: {hairpin.ds:.1f} cal/mol/K')
# Hairpin is problematic if Tm > annealing temp - 10
annealing_temp = 60.0
if hairpin.tm > annealing_temp - 10:
print(f'WARNING: Hairpin Tm too high for annealing at {annealing_temp}C')
Check Self-Dimer (Homodimer)
primer = 'ATGCGATCGATCGATCGATC'
homodimer = primer3.calc_homodimer(primer)
print(f'Homodimer Tm: {homodimer.tm:.1f}C')
print(f'Homodimer dG: {homodimer.dg:.1f} cal/mol')
# Self-dimer is problematic if Tm is close to annealing temp
if homodimer.tm > 40:
print('WARNING: Significant self-dimer potential')
Check Primer-Primer Dimer (Heterodimer)
forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'
heterodimer = primer3.calc_heterodimer(forward, reverse)
print(f'Heterodimer Tm: {heterodimer.tm:.1f}C')
print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')
if heterodimer.tm > 40:
print('WARNING: Significant primer dimer potential between forward and reverse')
What ships with it
1 file beside SKILL.md in the same directory: the scripts, references and assets a skill reads on demand. Not counted in the per-session cost; read them before you install if any of them is executable.
What this file has done since we first saw it
Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.
- 2d ago First seen · 338 lines · 57 tokens per session scan A 8ddc9a66c6d5
bio-primer-design-primer-validation is a skill published in the GitHub repository thesecondfox/skill (3 stars, last pushed 5mo ago), licensed MIT. It adds 57 tokens to every session and 3,338 once invoked, about $0.0003 per session on Opus 5. A static security scan graded it A with 0 findings. No closer match exists in the catalogue, so it is treated as the original; first seen 2026-09-03.
Other skills, from other repositories
instrument-data-to-allotrope
Convert laboratory instrument output files (PDF, CSV, Excel, TXT) to Allotrope Simple Model (ASM) JSON format or flattened 2D CSV. Use this skill when scientists need to standardize instrument data for LIMS systems, data lakes, or downstream analysis. Supports auto-detection of instrument types. Outputs include full…
matlab
Build, review, migrate, and safely plan MATLAB or GNU Octave numerical workflows, including arrays, tabular/time data, tests, projects, graphics, MAT files, and explicit Python interoperability.
exploratory-data-analysis
Perform bounded, local exploratory analysis of explicitly supported scientific files. Use for redacted CSV/TSV/JSON profiles; optional NumPy, HDF5, FASTA/FASTQ, and basic image metadata inspection; missingness/leakage audits; outlier and transformation sensitivity; and rigorous EDA report scaffolds. Other domain…
phylogenetics
Build and analyze phylogenetic trees using MAFFT (multiple alignment), IQ-TREE 2 (maximum likelihood), and FastTree (fast NJ/ML). Visualize with ETE3 or FigTree. For evolutionary analysis, microbial genomics, viral phylodynamics, protein family analysis, and molecular clock studies.
research-engineer
An uncompromising Academic Research Engineer. Operates with absolute scientific rigor, objective criticism, and zero flair. Focuses on theoretical correctness, formal verification, and optimal implementation across any required technology.
mapping-to-snomed
Maps clinical concept spans extracted by OpenMed to SNOMED CT concepts through a USER-SUPPLIED terminology server (the user's own Ontoserver, Snowstorm, or UMLS/UTS), never a bundled vocabulary. Use when the user wants to code findings, disorders, procedures, body structures, or substances to SNOMED CT, run an ECL…