bio-primer-design-qpcr-primers

bio-primer-design-qpcr-primers is a skill for Claude Code, Codex from thesecondfox/skill. It costs 59 tokens per session (2,450 once invoked), scanned A, original, MIT.

A guide to designing primers and internal probes for qPCR assays. qPCR is a laboratory method that measures DNA amplification during the reaction, while a probe adds sequence-specific detection.

In plain words
What is it for?
Use it to design qPCR primer pairs with TaqMan or molecular-beacon probes from a template sequence.
Why use it?
It helps choose primers and probes that meet temperature, spacing, and assay constraints.

Skill for Claude CodeCodex

Written for no agent in particular: nothing here depends on one.

Good fit Use it to design qPCR primer pairs with TaqMan or molecular-beacon probes from a template sequence.

Compare 6 skills from other repositories ↓
Install with agentmods
npx agentmods add skills/thesecondfox/skill/bio-primer-design-qpcr-primers
Install

Getting it into your agent

One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.

Any agent
npx skills add thesecondfox/skill --skill bio-primer-design-qpcr-primers
Clone the repo
git clone --depth 1 https://github.com/thesecondfox/skill

Made for: Claude Code, Codex.

Wrote this? Show the measurements

A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.

agentmods badge for bio-primer-design-qpcr-primers

README.md
[![agentmods](https://agentmods.dev/badge/skills/thesecondfox/skill/bio-primer-design-qpcr-primers/github.svg)](https://agentmods.dev/skills/thesecondfox/skill/bio-primer-design-qpcr-primers)
Your own site
<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-primer-design-qpcr-primers"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-primer-design-qpcr-primers/github.svg" alt="Measured on agentmods" height="20"></a>

Or the 80×15 button, for a site that already has a row of RSS and ATOM ones. Only the verdict fits; the numbers stay here.

agentmods 80×15 button for bio-primer-design-qpcr-primers

Your own site · 80×15
<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-primer-design-qpcr-primers"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-primer-design-qpcr-primers.svg" alt="Reviewed on agentmods" width="80" height="20"></a>
Per session 59 Skills are progressive disclosure: only the name and description are preloaded; the body loads when the skill is used.
When invoked 2,450 The whole file, excluding the scripts and references it only reads on demand.
Security scan A 0 findings. A grade says what 26 rules found in the file — not that it is safe.
Origin original No closer match found in the catalogue.
Token cost

What it costs to keep this loaded

Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.

ModelPer sessionOnce invoked
Fable 5.1 $0.00059 $0.02450
Opus 5 $0.00030 $0.01225
Sonnet 5 $0.00012 $0.00490
Haiku 4.5 $0.00006 $0.00245

Measured 7d ago against content hash f0ff6b9ab4a8, method: parsed. Prices are Anthropic first-party input rates as of 2026-09-11, from the pricing page.

Security

Grade A, and why

bio-primer-design-qpcr-primers scanned grade A with 0 findings against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 7d ago.

A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.

Nothing flagged

None of the 26 patterns this scan looks for appear in this file: no shell pipes, no recursive deletes, no credential paths, no hidden text, no instruction-override or anti-refusal phrasing, no agent-config snooping. That is not a guarantee, it is the absence of the things that are checkable.

Common_Skills/bio-primer-design-qpcr-primers/SKILL.md · 267 lines

How it starts

The opening of the file, as written. The whole thing — 267 lines — stays where its author put it; the contents beside it link to each section on GitHub.

Version Compatibility

Reference examples tested with: BioPython 1.83+, pandas 2.2+, primer3-py 2.0+

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

qPCR Primer and Probe Design

Design primers and internal probes for quantitative PCR using primer3-py.

"Design qPCR primers with probe" → Generate primer pairs plus internal TaqMan/molecular beacon probes with constrained Tm and spacing.

  • Python: primer3.design_primers(seq_args, global_args) with PRIMER_PICK_INTERNAL_OLIGO=1 (primer3-py)

Required Imports

import primer3
from Bio import SeqIO

Design Primers with TaqMan Probe

sequence = 'ATGCGTACGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG' * 3

result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': sequence},
    global_args={
        'PRIMER_PICK_LEFT_PRIMER': 1,
        'PRIMER_PICK_RIGHT_PRIMER': 1,
        'PRIMER_PICK_INTERNAL_OLIGO': 1,  # Design internal probe
        'PRIMER_PRODUCT_SIZE_RANGE': [[70, 150]],  # Short amplicons for qPCR
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 58.0,
        'PRIMER_MAX_TM': 62.0,
        'PRIMER_INTERNAL_OPT_TM': 70.0,  # Probe Tm ~10C higher
        'PRIMER_INTERNAL_MIN_TM': 68.0,
        'PRIMER_INTERNAL_MAX_TM': 72.0,
        'PRIMER_INTERNAL_MIN_SIZE': 18,
        'PRIMER_INTERNAL_OPT_SIZE': 25,
        'PRIMER_INTERNAL_MAX_SIZE': 30,
    }
)

Extract Probe Results

num_returned = result['PRIMER_PAIR_NUM_RETURNED']
print(f'Found {num_returned} primer/probe sets')

for i in range(num_returned):
    left = result[f'PRIMER_LEFT_{i}_SEQUENCE']
    right = result[f'PRIMER_RIGHT_{i}_SEQUENCE']
    probe = result[f'PRIMER_INTERNAL_{i}_SEQUENCE']
    probe_tm = result[f'PRIMER_INTERNAL_{i}_TM']
    left_tm = result[f'PRIMER_LEFT_{i}_TM']
    right_tm = result[f'PRIMER_RIGHT_{i}_TM']
    product_size = result[f'PRIMER_PAIR_{i}_PRODUCT_SIZE']

    print(f'Set {i}:')
    print(f'  Forward: {left} (Tm: {left_tm:.1f}C)')
    print(f'  Reverse: {right} (Tm: {right_tm:.1f}C)')
    print(f'  Probe:   {probe} (Tm: {probe_tm:.1f}C)')
    print(f'  Product: {product_size}bp')

Read the full file on GitHub · 267 lines

Files

What ships with it

1 file beside SKILL.md in the same directory: the scripts, references and assets a skill reads on demand. Not counted in the per-session cost; read them before you install if any of them is executable.

Changes

What this file has done since we first saw it

Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.

  1. 7d ago First seen · 267 lines · 59 tokens per session scan A f0ff6b9ab4a8

Subscribe to this mod's changes

bio-primer-design-qpcr-primers is a skill published in the GitHub repository thesecondfox/skill (3 stars, last pushed 5mo ago), licensed MIT. It adds 59 tokens to every session and 2,450 once invoked, about $0.0003 per session on Opus 5. A static security scan graded it A with 0 findings. No closer match exists in the catalogue, so it is treated as the original; first seen 2026-09-03.

Related

Other skills, from other repositories

instrument-data-to-allotrope

Convert laboratory instrument output files (PDF, CSV, Excel, TXT) to Allotrope Simple Model (ASM) JSON format or flattened 2D CSV. Use this skill when scientists need to standardize instrument data for LIMS systems, data lakes, or downstream analysis. Supports auto-detection of instrument types. Outputs include full…

anthropics/knowledge-work-plugins · 123 tokens

exploratory-data-analysis

Perform bounded, local exploratory analysis of explicitly supported scientific files. Use for redacted CSV/TSV/JSON profiles; optional NumPy, HDF5, FASTA/FASTQ, and basic image metadata inspection; missingness/leakage audits; outlier and transformation sensitivity; and rigorous EDA report scaffolds. Other domain…

K-Dense-AI/scientific-agent-skills · 83 tokens

matlab

Build, review, migrate, and safely plan MATLAB or GNU Octave numerical workflows, including arrays, tabular/time data, tests, projects, graphics, MAT files, and explicit Python interoperability.

K-Dense-AI/scientific-agent-skills · 42 tokens

phylogenetics

Build and analyze phylogenetic trees using MAFFT (multiple alignment), IQ-TREE 2 (maximum likelihood), and FastTree (fast NJ/ML). Visualize with ETE3 or FigTree. For evolutionary analysis, microbial genomics, viral phylodynamics, protein family analysis, and molecular clock studies.

K-Dense-AI/scientific-agent-skills · 68 tokens

research-engineer

An uncompromising Academic Research Engineer. Operates with absolute scientific rigor, objective criticism, and zero flair. Focuses on theoretical correctness, formal verification, and optimal implementation across any required technology.

davila7/claude-code-templates · 43 tokens

mapping-to-snomed

Maps clinical concept spans extracted by OpenMed to SNOMED CT concepts through a USER-SUPPLIED terminology server (the user's own Ontoserver, Snowstorm, or UMLS/UTS), never a bundled vocabulary. Use when the user wants to code findings, disorders, procedures, body structures, or substances to SNOMED CT, run an ECL…

maziyarpanahi/openmed · 205 tokens