bio-rna-structure-secondary-structure-prediction

bio-rna-structure-secondary-structure-prediction is a skill for Claude Code, Codex from thesecondfox/skill. It costs 74 tokens per session (2,592 once invoked), scanned A, original, MIT.

An RNA folding workflow that predicts secondary structure—the way an RNA strand pairs with itself or another strand. It calculates the most stable predicted fold, alternative pairing probabilities, consensus folds from alignments, and RNA-RNA interaction structures.

In plain words
What is it for?
Use it to fold individual RNA sequences, compare aligned sequences, estimate base-pair probabilities, and predict interactions between two RNA molecules.
Why use it?
It helps estimate RNA shape and uncertainty from sequence data instead of requiring every possible pairing to be checked manually.

Skill for Claude CodeCodex

Written for no agent in particular: nothing here depends on one.

Good fit Use it to fold individual RNA sequences, compare aligned sequences, estimate base-pair probabilities, and predict interactions between two RNA molecules.

Compare 6 skills from other repositories ↓
Install with agentmods
npx agentmods add skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction
Install

Getting it into your agent

One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.

Any agent
npx skills add thesecondfox/skill --skill bio-rna-structure-secondary-structure-prediction
Clone the repo
git clone --depth 1 https://github.com/thesecondfox/skill

Made for: Claude Code, Codex.

Wrote this? Show the measurements

A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.

agentmods badge for bio-rna-structure-secondary-structure-prediction

README.md
[![agentmods](https://agentmods.dev/badge/skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction/github.svg)](https://agentmods.dev/skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction)
Your own site
<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction/github.svg" alt="Measured on agentmods" height="20"></a>

Or the 80×15 button, for a site that already has a row of RSS and ATOM ones. Only the verdict fits; the numbers stay here.

agentmods 80×15 button for bio-rna-structure-secondary-structure-prediction

Your own site · 80×15
<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-rna-structure-secondary-structure-prediction.svg" alt="Reviewed on agentmods" width="80" height="20"></a>
Per session 74 Skills are progressive disclosure: only the name and description are preloaded; the body loads when the skill is used.
When invoked 2,592 The whole file, excluding the scripts and references it only reads on demand.
Security scan A 0 findings. A grade says what 26 rules found in the file — not that it is safe.
Origin original No closer match found in the catalogue.
Token cost

What it costs to keep this loaded

Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.

ModelPer sessionOnce invoked
Fable 5.1 $0.00074 $0.02592
Opus 5 $0.00037 $0.01296
Sonnet 5 $0.00015 $0.00518
Haiku 4.5 $0.00007 $0.00259

Measured 6d ago against content hash 23cd19a46df4, method: parsed. Prices are Anthropic first-party input rates as of 2026-09-10, from the pricing page.

Security

Grade A, and why

bio-rna-structure-secondary-structure-prediction scanned grade A with 0 findings against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 6d ago.

A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.

Nothing flagged

None of the 26 patterns this scan looks for appear in this file: no shell pipes, no recursive deletes, no credential paths, no hidden text, no instruction-override or anti-refusal phrasing, no agent-config snooping. That is not a guarantee, it is the absence of the things that are checkable.

Common_Skills/bio-rna-structure-secondary-structure-prediction/SKILL.md · 294 lines

How it starts

The opening of the file, as written. The whole thing — 294 lines — stays where its author put it; the contents beside it link to each section on GitHub.

Version Compatibility

Reference examples tested with: Infernal 1.1+, matplotlib 3.8+, numpy 1.26+

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures
  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Secondary Structure Prediction

"Predict the secondary structure of my RNA sequence" → Compute minimum free energy (MFE) folding, base-pair probabilities via partition function, and consensus structures from alignments using thermodynamic models.

  • CLI: RNAfold for single-sequence MFE/partition folding
  • CLI: RNAalifold for consensus structure from alignment
  • CLI: RNAcofold for RNA-RNA interaction structure

Predict RNA secondary structures using thermodynamic models. ViennaRNA provides MFE folding, partition function analysis, consensus structure prediction from alignments, and RNA-RNA interaction prediction.

RNAfold: Single Sequence Folding

MFE Structure

# Basic MFE folding (reads sequence from stdin or file)
echo "GGGAAACCC" | RNAfold

# With partition function (-p) and base-pair probabilities
echo "GGGAAACCC" | RNAfold -p

# Output PostScript dot plot and structure plot
echo ">myRNA" > input.fa
echo "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA" >> input.fa
RNAfold -p --noPS < input.fa  # Suppress PostScript files

Key RNAfold Options

Option Description
-p Compute partition function and base-pair probabilities
--MEA Compute maximum expected accuracy structure
-d2 Dangling end energies on both sides of helices (default)
-T 37 Temperature in Celsius (default: 37)
--noLP No lonely pairs (isolated base pairs)
--noPS Suppress PostScript output files
-C Read structure constraints from input
--shape Incorporate SHAPE reactivity data

Read the full file on GitHub · 294 lines

Files

What ships with it

1 file beside SKILL.md in the same directory: the scripts, references and assets a skill reads on demand. Not counted in the per-session cost; read them before you install if any of them is executable.

Changes

What this file has done since we first saw it

Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.

  1. 6d ago First seen · 294 lines · 74 tokens per session scan A 23cd19a46df4

Subscribe to this mod's changes

bio-rna-structure-secondary-structure-prediction is a skill published in the GitHub repository thesecondfox/skill (3 stars, last pushed 5mo ago), licensed MIT. It adds 74 tokens to every session and 2,592 once invoked, about $0.0004 per session on Opus 5. A static security scan graded it A with 0 findings. No closer match exists in the catalogue, so it is treated as the original; first seen 2026-09-03.

Related

Other skills, from other repositories

instrument-data-to-allotrope

Convert laboratory instrument output files (PDF, CSV, Excel, TXT) to Allotrope Simple Model (ASM) JSON format or flattened 2D CSV. Use this skill when scientists need to standardize instrument data for LIMS systems, data lakes, or downstream analysis. Supports auto-detection of instrument types. Outputs include full…

anthropics/knowledge-work-plugins · 123 tokens

matlab

Build, review, migrate, and safely plan MATLAB or GNU Octave numerical workflows, including arrays, tabular/time data, tests, projects, graphics, MAT files, and explicit Python interoperability.

K-Dense-AI/scientific-agent-skills · 42 tokens

exploratory-data-analysis

Perform bounded, local exploratory analysis of explicitly supported scientific files. Use for redacted CSV/TSV/JSON profiles; optional NumPy, HDF5, FASTA/FASTQ, and basic image metadata inspection; missingness/leakage audits; outlier and transformation sensitivity; and rigorous EDA report scaffolds. Other domain…

K-Dense-AI/scientific-agent-skills · 83 tokens

phylogenetics

Build and analyze phylogenetic trees using MAFFT (multiple alignment), IQ-TREE 2 (maximum likelihood), and FastTree (fast NJ/ML). Visualize with ETE3 or FigTree. For evolutionary analysis, microbial genomics, viral phylodynamics, protein family analysis, and molecular clock studies.

K-Dense-AI/scientific-agent-skills · 68 tokens

research-engineer

An uncompromising Academic Research Engineer. Operates with absolute scientific rigor, objective criticism, and zero flair. Focuses on theoretical correctness, formal verification, and optimal implementation across any required technology.

davila7/claude-code-templates · 43 tokens

mapping-to-snomed

Maps clinical concept spans extracted by OpenMed to SNOMED CT concepts through a USER-SUPPLIED terminology server (the user's own Ontoserver, Snowstorm, or UMLS/UTS), never a bundled vocabulary. Use when the user wants to code findings, disorders, procedures, body structures, or substances to SNOMED CT, run an ECL…

maziyarpanahi/openmed · 205 tokens