Getting it into your agent
One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.
npx skills add thesecondfox/skill --skill bio-workflows-smrna-pipelinegit clone --depth 1 https://github.com/thesecondfox/skillWrote this? Show the measurements
A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.
[](https://agentmods.dev/skills/thesecondfox/skill/bio-workflows-smrna-pipeline)<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-workflows-smrna-pipeline"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-workflows-smrna-pipeline/github.svg" alt="Measured on agentmods" height="20"></a>Or the 80×15 button, for a site that already has a row of RSS and ATOM ones. Only the verdict fits; the numbers stay here.
<a href="https://agentmods.dev/skills/thesecondfox/skill/bio-workflows-smrna-pipeline"><img src="https://agentmods.dev/badge/skills/thesecondfox/skill/bio-workflows-smrna-pipeline.svg" alt="Reviewed on agentmods" width="80" height="20"></a>What it costs to keep this loaded
Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.
| Model | Per session | Once invoked |
|---|---|---|
| Fable 5.1 | $0.00041 | $0.00645 |
| Opus 5 | $0.00020 | $0.00322 |
| Sonnet 5 | $0.00008 | $0.00129 |
| Haiku 4.5 | $0.00004 | $0.00064 |
Grade A, and why
bio-workflows-smrna-pipeline scanned grade A with 0 findings against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 5d ago.
A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.
Nothing flagged
None of the 26 patterns this scan looks for appear in this file: no shell pipes, no recursive deletes, no credential paths, no hidden text, no instruction-override or anti-refusal phrasing, no agent-config snooping. That is not a guarantee, it is the absence of the things that are checkable.
How it starts
The opening of the file, as written. The whole thing — 80 lines — stays where its author put it; the contents beside it link to each section on GitHub.
Version Compatibility
Reference examples tested with: DESeq2 1.42+, cutadapt 4.4+
Before using code patterns, verify installed versions match. If versions differ:
- R:
packageVersion('<pkg>')then?function_nameto verify parameters - CLI:
<tool> --versionthen<tool> --helpto confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Small RNA-seq Pipeline
"Analyze my small RNA-seq data from FASTQ to differential miRNAs" → Orchestrate adapter trimming (cutadapt), miRNA quantification (miRDeep2/miRge3), novel miRNA discovery, differential expression (DESeq2), and target prediction (miRanda).
Pipeline Overview
FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction
Step 1: Preprocessing
# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
--minimum-length 18 --maximum-length 30 \
-o trimmed.fastq.gz reads.fastq.gz
Step 2: miRDeep2 Analysis
# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
-m -p genome_index -s reads_collapsed.fa \
-t reads_collapsed_vs_genome.arf
# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa
Step 3: Differential Expression
library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)
Step 4: Target Prediction
# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
QC Checkpoints
- After trimming: Size distribution should peak at 21-23nt
- After alignment: >70% mapping rate expected
- After DE: Check volcano plot and PCA
Related Skills
- small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
- small-rna-seq/differential-mirna - DE analysis
- small-rna-seq/target-prediction - Target analysis
What ships with it
1 file beside SKILL.md in the same directory: the scripts, references and assets a skill reads on demand. Not counted in the per-session cost; read them before you install if any of them is executable.
What this file has done since we first saw it
Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.
- 5d ago First seen · 80 lines · 41 tokens per session scan A 15280959ea5b
bio-workflows-smrna-pipeline is a skill published in the GitHub repository thesecondfox/skill (3 stars, last pushed 5mo ago), licensed MIT. It adds 41 tokens to every session and 645 once invoked, about $0.0002 per session on Opus 5. A static security scan graded it A with 0 findings. No closer match exists in the catalogue, so it is treated as the original; first seen 2026-09-03.
Other skills, from other repositories
instrument-data-to-allotrope
Convert laboratory instrument output files (PDF, CSV, Excel, TXT) to Allotrope Simple Model (ASM) JSON format or flattened 2D CSV. Use this skill when scientists need to standardize instrument data for LIMS systems, data lakes, or downstream analysis. Supports auto-detection of instrument types. Outputs include full…
exploratory-data-analysis
Perform bounded, local exploratory analysis of explicitly supported scientific files. Use for redacted CSV/TSV/JSON profiles; optional NumPy, HDF5, FASTA/FASTQ, and basic image metadata inspection; missingness/leakage audits; outlier and transformation sensitivity; and rigorous EDA report scaffolds. Other domain…
matlab
Build, review, migrate, and safely plan MATLAB or GNU Octave numerical workflows, including arrays, tabular/time data, tests, projects, graphics, MAT files, and explicit Python interoperability.
phylogenetics
Build and analyze phylogenetic trees using MAFFT (multiple alignment), IQ-TREE 2 (maximum likelihood), and FastTree (fast NJ/ML). Visualize with ETE3 or FigTree. For evolutionary analysis, microbial genomics, viral phylodynamics, protein family analysis, and molecular clock studies.
research-engineer
An uncompromising Academic Research Engineer. Operates with absolute scientific rigor, objective criticism, and zero flair. Focuses on theoretical correctness, formal verification, and optimal implementation across any required technology.
mapping-to-snomed
Maps clinical concept spans extracted by OpenMed to SNOMED CT concepts through a USER-SUPPLIED terminology server (the user's own Ontoserver, Snowstorm, or UMLS/UTS), never a bundled vocabulary. Use when the user wants to code findings, disorders, procedures, body structures, or substances to SNOMED CT, run an ECL…