sequence

Sequence

Use this skill when the user supplies a DNA sequence and asks for ORFs, translation, restriction sites, Kozak context, primer checks, local FASTA record matching, or simple bench-style sequence QA.

Contract

• These tools operate only on supplied sequence strings and explicitly supplied local reference FASTA files.
• They do not use active genome context or external services.
• Report deterministic sequence facts directly. Add biological interpretation only when the user supplies enough context or separate source evidence.

Tool Flow

• Use sequence.analyze when more than one deterministic sequence fact may be needed.
• Use sequence.match_reference when a local FASTA can identify the supplied sequence before downstream reasoning.
• Use sequence.translate for frame/strand translation.
• Use sequence.find_orfs for ATG-to-stop ORF discovery.
• Use sequence.find_restriction_sites for common enzymes or custom motifs.
• Use sequence.classify_kozak for ATG start-context checks.
• Use sequence.check_primers for basic GC, Wallace Tm, self-complementarity, and optional template amplicons.

Examples:

• sequence.translate with {"sequence":"ATGGCCATTGTAATGGGCCGCTGA","frame":1}
• sequence.find_orfs with {"sequence":"AAATGAAATAG","min_aa":1}
• sequence.find_restriction_sites with {"sequence":"GAATTCGGATCC","enzymes":["EcoRI","BamHI"]}
• sequence.match_reference with {"sequence":"ATGAAATAA","reference_fasta":"refs.fa"}

Answering

Give the computed result and enough coordinates or frame details to make the answer auditable. Do not turn sequence utility output into medical or personal-genome interpretation.

Cross-Capability Synthesis

A scope-limited result from this capability is not a final user-facing answer when other Genomi capabilities can contribute orthogonal evidence to the same question. Returning "cannot answer" while applicable capabilities remain unexamined is a host-agent failure mode.

Tools

sequence.analyze