bio-clip-seq-clip-preprocessing

bio-clip-seq-clip-preprocessing is a skill for Claude Code, Codex from GPTomics/bioSkills. It costs 134 tokens per session (5,361 once invoked), scanned A, original, MIT.

A preparation workflow that turns raw CLIP-seq reads into cleaned, duplicate-reduced files ready for alignment. CLIP-seq uses short DNA copies of protein-bound RNA, and its read ends can preserve the exact crosslink position.

In plain words
What is it for?
Use it to extract UMIs, trim adapters, filter read lengths, and collapse PCR duplicates for eCLIP, iCLIP, PAR-CLIP, and related protocols.
Why use it?
It removes adapters and unusable reads while preserving the positional signal needed for accurate binding-site detection. It also reduces PCR duplicates that could falsely inflate binding.

Skill for Claude CodeCodex

Written for no agent in particular: nothing here depends on one.

Good fit Use it to extract UMIs, trim adapters, filter read lengths, and collapse PCR duplicates for eCLIP, iCLIP, PAR-CLIP, and related protocols.

Compare 6 skills from other repositories ↓
Install with agentmods
npx agentmods add skills/gptomics/bioskills/clip-preprocessing
Install

Getting it into your agent

One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.

Any agent
npx skills add GPTomics/bioSkills --skill clip-preprocessing
Clone the repo
git clone --depth 1 https://github.com/GPTomics/bioSkills

Made for: Claude Code, Codex.

Wrote this? Show the measurements

A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.

agentmods badge for bio-clip-seq-clip-preprocessing

README.md
[![agentmods](https://agentmods.dev/badge/skills/gptomics/bioskills/clip-preprocessing/github.svg)](https://agentmods.dev/skills/gptomics/bioskills/clip-preprocessing)
Your own site
<a href="https://agentmods.dev/skills/gptomics/bioskills/clip-preprocessing"><img src="https://agentmods.dev/badge/skills/gptomics/bioskills/clip-preprocessing/github.svg" alt="Measured on agentmods" height="20"></a>

Or the 80×15 button, for a site that already has a row of RSS and ATOM ones. Only the verdict fits; the numbers stay here.

agentmods 80×15 button for bio-clip-seq-clip-preprocessing

Your own site · 80×15
<a href="https://agentmods.dev/skills/gptomics/bioskills/clip-preprocessing"><img src="https://agentmods.dev/badge/skills/gptomics/bioskills/clip-preprocessing.svg" alt="Reviewed on agentmods" width="80" height="20"></a>
Per session 134 Skills are progressive disclosure: only the name and description are preloaded; the body loads when the skill is used.
When invoked 5,361 The whole file, excluding the scripts and references it only reads on demand.
Security scan A 0 findings. A grade says what 26 rules found in the file — not that it is safe.
Origin original No closer match found in the catalogue.
Token cost

What it costs to keep this loaded

Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.

ModelPer sessionOnce invoked
Fable 5.1 $0.00134 $0.05361
Opus 5 $0.00067 $0.02681
Sonnet 5 $0.00027 $0.01072
Haiku 4.5 $0.00013 $0.00536

Measured 7d ago against content hash 05dfc59ca5b5, method: parsed. Prices are Anthropic first-party input rates as of 2026-09-10, from the pricing page.

Security

Grade A, and why

bio-clip-seq-clip-preprocessing scanned grade A with 0 findings against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 7d ago.

The scan reads SKILL.md. This mod also ships 1 executable file (examples/preprocess_clip.sh), listed below but not scanned — reading those needs a real analyzer, not pattern matching.

A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.

Nothing flagged

None of the 26 patterns this scan looks for appear in this file: no shell pipes, no recursive deletes, no credential paths, no hidden text, no instruction-override or anti-refusal phrasing, no agent-config snooping. That is not a guarantee, it is the absence of the things that are checkable.

Origin

Copies of this mod

1 near-identical copy found in the catalogue:

clip-seq/clip-preprocessing/SKILL.md · 243 lines

How it starts

The opening of the file, as written. The whole thing — 243 lines — stays where its author put it; the contents beside it link to each section on GitHub.

Version Compatibility

Reference examples tested with: umi_tools 1.1.5+, cutadapt 4.6+, fastp 0.23.4+, samtools 1.19+, pysam 0.22+, picard 3.1+, preseq 3.2+.

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures
  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

CLIP-seq Preprocessing

"Preprocess raw CLIP reads into UMI-deduplicated, alignable FASTQ" -> Extract random barcodes, trim adapters without disturbing the 5' truncation site, length-filter to remove unmappable shorts, and (post-alignment) collapse PCR duplicates by UMI + position. The 5' end of the read carries the iCLIP/eCLIP truncation signature one base downstream of the protein-RNA crosslink; preserving this base is the single most important constraint of CLIP preprocessing.

  • CLI (eCLIP, paired-end): umi_tools extract --bc-pattern=NNNNNNNNNN --stdin R1.fq.gz --read2-in R2.fq.gz --stdout R1_umi.fq.gz --read2-out R2_umi.fq.gz
  • CLI (iCLIP/iCLIP2, single-end): umi_tools extract --bc-pattern=NNNXXXXNN --extract-method=string --stdin R1.fq.gz --stdout R1_umi.fq.gz (3+2 random Ns flanking a 4 nt library barcode; demultiplex by the X positions first if multiplexed)
  • CLI (PAR-CLIP): umi_tools extract --bc-pattern=NNNN ... (most protocols use 4 nt random barcodes; verify the lab's exact prep)
  • CLI (3' trim only, eCLIP convention): cutadapt -a AGATCGGAAGAGCACACGTCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --quality-base 33 --quality-cutoff 6 -m 18 -o R1.trim.fq.gz -p R2.trim.fq.gz R1_umi.fq.gz R2_umi.fq.gz

The eCLIP convention is: trim quality and adapter from the 3' end ONLY. The 5' end of read 2 (in paired-end eCLIP) is the truncation site of the RT enzyme at the protein-RNA adduct, located one nucleotide downstream of the crosslink. Trimming the 5' end discards that exact base. cutadapt -g, fastp --trim_front1, and aggressive quality trimming of the 5' end are all banned for CLIP unless a documented protocol-specific reason exists.

Read the full file on GitHub · 243 lines

Files

What ships with it

2 files beside SKILL.md in the same directory: the scripts, references and assets a skill reads on demand. Not counted in the per-session cost; read them before you install if any of them is executable.

Changes

What this file has done since we first saw it

Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.

  1. 7d ago First seen · 243 lines · 134 tokens per session scan A 05dfc59ca5b5

Subscribe to this mod's changes

bio-clip-seq-clip-preprocessing is a skill published in the GitHub repository GPTomics/bioSkills (1,199 stars, last pushed 26d ago), licensed MIT. It adds 134 tokens to every session and 5,361 once invoked, about $0.0007 per session on Opus 5. A static security scan graded it A with 0 findings. No closer match exists in the catalogue, so it is treated as the original; first seen 2026-09-03.

Related

Other skills, from other repositories

instrument-data-to-allotrope

Convert laboratory instrument output files (PDF, CSV, Excel, TXT) to Allotrope Simple Model (ASM) JSON format or flattened 2D CSV. Use this skill when scientists need to standardize instrument data for LIMS systems, data lakes, or downstream analysis. Supports auto-detection of instrument types. Outputs include full…

anthropics/knowledge-work-plugins · 123 tokens

matlab

Build, review, migrate, and safely plan MATLAB or GNU Octave numerical workflows, including arrays, tabular/time data, tests, projects, graphics, MAT files, and explicit Python interoperability.

K-Dense-AI/scientific-agent-skills · 42 tokens

exploratory-data-analysis

Perform bounded, local exploratory analysis of explicitly supported scientific files. Use for redacted CSV/TSV/JSON profiles; optional NumPy, HDF5, FASTA/FASTQ, and basic image metadata inspection; missingness/leakage audits; outlier and transformation sensitivity; and rigorous EDA report scaffolds. Other domain…

K-Dense-AI/scientific-agent-skills · 83 tokens

phylogenetics

Build and analyze phylogenetic trees using MAFFT (multiple alignment), IQ-TREE 2 (maximum likelihood), and FastTree (fast NJ/ML). Visualize with ETE3 or FigTree. For evolutionary analysis, microbial genomics, viral phylodynamics, protein family analysis, and molecular clock studies.

K-Dense-AI/scientific-agent-skills · 68 tokens

research-engineer

An uncompromising Academic Research Engineer. Operates with absolute scientific rigor, objective criticism, and zero flair. Focuses on theoretical correctness, formal verification, and optimal implementation across any required technology.

davila7/claude-code-templates · 43 tokens

mapping-to-snomed

Maps clinical concept spans extracted by OpenMed to SNOMED CT concepts through a USER-SUPPLIED terminology server (the user's own Ontoserver, Snowstorm, or UMLS/UTS), never a bundled vocabulary. Use when the user wants to code findings, disorders, procedures, body structures, or substances to SNOMED CT, run an ECL…

maziyarpanahi/openmed · 205 tokens