bio-motif-search

Version Compatibility

Reference examples tested with: BioPython 1.83+

Before using code patterns, verify installed versions match. If versions differ:

• Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Motif Search

"Search for a sequence motif or binding site pattern" → Scan sequences for patterns using IUPAC ambiguity codes, regex, or position weight matrices to locate transcription factor binding sites, regulatory elements, or custom motifs.

• Python: Bio.motifs for PWM scanning, re for regex pattern matching

Find patterns and motifs in biological sequences using Biopython and regex.

Required Imports

from Bio.Seq import Seq
from Bio import motifs
import re

Core Methods

find() - First Occurrence

seq = Seq('ATGCGAATTCGATCGAATTCGATC')
pos = seq.find('GAATTC')  # Returns 4 (first position)

Returns -1 if not found.

count() - Count Occurrences

seq = Seq('ATGCGAATTCGATCGAATTCGATC')
n = seq.count('GAATTC')  # Returns 2

find() with Start Position

seq = Seq('ATGCGAATTCGATCGAATTCGATC')
first = seq.find('GAATTC')        # 4
second = seq.find('GAATTC', 5)    # 14 (search from position 5)

Code Patterns

Find All Occurrences

def find_all(seq, pattern):
    pattern = str(pattern)
    seq_str = str(seq)
    positions = []
    pos = seq_str.find(pattern)
    while pos != -1:
        positions.append(pos)
        pos = seq_str.find(pattern, pos + 1)
    return positions

seq = Seq('ATGCGAATTCGATCGAATTCGATC')
positions = find_all(seq, 'GAATTC')  # [4, 14]

Search Both Strands

def find_both_strands(seq, pattern):
    results = []
    for pos in find_all(seq, pattern):
        results.append(('+', pos))
    rc = seq.reverse_complement()
    for pos in find_all(rc, pattern):
        results.append(('-', len(seq) - pos - len(pattern)))
    return results