bio-sequence-properties

Version Compatibility

Reference examples tested with: BioPython 1.83+, samtools 1.19+

Before using code patterns, verify installed versions match. If versions differ:

• Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Sequence Properties

Calculate physical and chemical properties of biological sequences using Biopython.

"Calculate GC content" → Compute the fraction of G+C bases in a nucleotide sequence.

• Python: gc_fraction(seq) (BioPython SeqUtils)

"Analyze protein properties" → Compute MW, pI, stability, hydrophobicity from an amino acid sequence.

• Python: ProteinAnalysis(str_seq) (BioPython ProtParam)

Required Imports

from Bio.Seq import Seq
from Bio.SeqUtils import gc_fraction, molecular_weight, GC123, GC_skew, nt_search, seq1, seq3
from Bio.SeqUtils.ProtParam import ProteinAnalysis

DNA/RNA Properties

GC Content

from Bio.SeqUtils import gc_fraction

seq = Seq('ATGCGATCGATCGATCGATCG')
gc = gc_fraction(seq)  # Returns 0.476... (fraction)
gc_percent = gc * 100  # Convert to percentage

Handle ambiguous bases:

gc = gc_fraction(seq, ambiguous='ignore')  # Ignore N bases in calculation
gc = gc_fraction(seq, ambiguous='weighted')  # Weight by probability

GC at Codon Positions (GC123)

Analyze GC content at each codon position (useful for codon bias analysis):

from Bio.SeqUtils import GC123

seq = Seq('ATGCGATCGATCGATCGATCG')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)
# gc_total: overall GC%
# gc_pos1: GC% at 1st codon position
# gc_pos2: GC% at 2nd codon position
# gc_pos3: GC% at 3rd codon position (wobble)

GC Skew

Calculate (G-C)/(G+C) in sliding windows to identify replication origins:

from Bio.SeqUtils import GC_skew

seq = Seq('ATGCGATCGATCGATCGATCG' * 10)
skew_values = GC_skew(seq, window=100)  # Returns list of skew values