PCR Primer Design

PCR Primer Design is a skill for Claude Code, Codex from TianGzlab/OmicsClaw. It costs 3 tokens per session (4,486 once invoked), scanned C, original, Apache-2.0.

A workflow for choosing and checking DNA primers, which are short sequences used to copy a specific region in PCR tests. It covers standard PCR, quantitative PCR (qPCR), fluorescent TaqMan probes, multiplex assays, and Sanger sequencing.

In plain words
What is it for?
Designing primers for cloning, genotyping, amplification, qPCR, probe-based assays, multiplex tests, and Sanger sequencing.
Why use it?
It helps avoid primers that fail to bind correctly, form unwanted structures, or produce non-specific results, while supporting the reporting requirements used for qPCR studies.

Skill for Claude CodeCodex

Written for no agent in particular: nothing here depends on one.

Good fit Designing primers for cloning, genotyping, amplification, qPCR, probe-based assays, multiplex tests, and Sanger sequencing.

Compare 6 skills from other repositories ↓
Install with agentmods
npx agentmods add skills/tiangzlab/omicsclaw/pcr-primer-design
Install

Getting it into your agent

One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.

Any agent
npx skills add TianGzlab/OmicsClaw --skill pcr-primer-design
Clone the repo
git clone --depth 1 https://github.com/TianGzlab/OmicsClaw

Made for: Claude Code, Codex.

Wrote this? Show the measurements

A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.

agentmods badge for PCR Primer Design

README.md
[![agentmods](https://agentmods.dev/badge/skills/tiangzlab/omicsclaw/pcr-primer-design/github.svg)](https://agentmods.dev/skills/tiangzlab/omicsclaw/pcr-primer-design)
Your own site
<a href="https://agentmods.dev/skills/tiangzlab/omicsclaw/pcr-primer-design"><img src="https://agentmods.dev/badge/skills/tiangzlab/omicsclaw/pcr-primer-design/github.svg" alt="Measured on agentmods" height="20"></a>

Or the 80×15 button, for a site that already has a row of RSS and ATOM ones. Only the verdict fits; the numbers stay here.

agentmods 80×15 button for PCR Primer Design

Your own site · 80×15
<a href="https://agentmods.dev/skills/tiangzlab/omicsclaw/pcr-primer-design"><img src="https://agentmods.dev/badge/skills/tiangzlab/omicsclaw/pcr-primer-design.svg" alt="Reviewed on agentmods" width="80" height="20"></a>
Per session 3 Skills are progressive disclosure: only the name and description are preloaded; the body loads when the skill is used.
When invoked 4,486 The whole file, excluding the scripts and references it only reads on demand.
Security scan C 1 finding. A grade says what 26 rules found in the file — not that it is safe.
Origin original No closer match found in the catalogue.
Token cost

What it costs to keep this loaded

Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.

ModelPer sessionOnce invoked
Fable 5.1 $0.00003 $0.04486
Opus 5 $0.00002 $0.02243
Sonnet 5 $0.00001 $0.00897
Haiku 4.5 $0.00000 $0.00449

Measured 10d ago against content hash 668d101dfd51, method: parsed. Prices are Anthropic first-party input rates as of 2026-09-09, from the pricing page.

Security

Grade C, and why

PCR Primer Design scanned grade C with 1 finding against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 10d ago.

The scan reads SKILL.md. This mod also ships 11 executable files (scripts/__init__.py, scripts/calculate_tm.py, scripts/check_dimers.py, …), listed below but not scanned — reading those needs a real analyzer, not pattern matching.

A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.

Encoded or obfuscated payloadhighSupply chain

base64 or hex that is decoded and executed hides what actually runs from anyone reading the file.

sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCA
knowledge_base/pcr-primer-design/SKILL.md · 403 lines

How it starts

The opening of the file, as written. The whole thing — 403 lines — stays where its author put it; the contents beside it link to each section on GitHub.

PCR Primer Design

Comprehensive PCR and qPCR primer design following MIQE 2.0 guidelines with automated validation.

When to Use This Skill

Use this skill when you need:

  • qPCR primers with MIQE 2.0 compliance for publication
  • Standard PCR primers for cloning, genotyping, or amplification (100-1000 bp)
  • TaqMan probes for probe-based qPCR assays
  • Rigorous validation (specificity, dimers, secondary structures)
  • Publication-quality documentation with comprehensive reports

Choose application based on:

  • qPCR: 70-140 bp amplicons, strict Tm matching (±2°C), MIQE compliance
  • Standard PCR: 100-1000 bp amplicons, general amplification
  • TaqMan: Probe-based detection, fluorescent assays
  • Multiplex: Multiple targets, compatible Tm requirements
  • Sequencing: Single-direction primers, Sanger sequencing

Don't use for:

  • ❌ In-situ hybridization probes → use specialized oligo design tools
  • ❌ NGS library prep primers → use adapter design workflows
  • ❌ CRISPR guide RNAs → use CRISPR-specific design tools

Quick Start (Example)

Test this skill with a sample qPCR design in ~2 minutes:

# Example: Design qPCR primers for a 700bp target sequence
from design_qpcr_primers import design_qpcr_primers

# Sample GAPDH sequence (700 bp, exon 3-4 region)
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGCTCTCTCTTCCTCTTGTGCTCTTGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACG"

primers = design_qpcr_primers(
    sequence=sequence,
    amplicon_size_range=(80, 120),
    num_return=5
)

print(f"Found {len(primers['primers'])} primer pairs")
print(f"MIQE-compliant: {sum(p.get('miqe_compliant', False) for p in primers['primers'])}")

Read the full file on GitHub · 403 lines

Changes

What this file has done since we first saw it

Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.

  1. 10d ago First seen · 403 lines · 3 tokens per session scan C 668d101dfd51

Subscribe to this mod's changes

PCR Primer Design is a skill published in the GitHub repository TianGzlab/OmicsClaw (160 stars, last pushed 1mo ago), licensed Apache-2.0. It adds 3 tokens to every session and 4,486 once invoked, about $0.0000 per session on Opus 5. A static security scan graded it C with 1 finding (encoded or obfuscated payload). No closer match exists in the catalogue, so it is treated as the original; first seen 2026-08-30.

Related

Other skills, from other repositories

scanpy

Standard single-cell RNA-seq analysis pipeline. Use for QC, normalization, dimensionality reduction (PCA/UMAP/t-SNE), clustering, differential expression, and visualization. Best for exploratory scRNA-seq analysis with established workflows. For deep learning models use scvi-tools; for data format questions use…

synthetic-sciences/openscience · 68 tokens

cellxgene-census-query

Query CZ CELLxGENE Census (61M+ cells). Filter by cell type/tissue/disease, retrieve expression data, and integrate with scanpy/PyTorch for population-scale single-cell analysis. Use this skill when: (1) Querying single-cell expression data by cell type, tissue, or disease, (2) Exploring available single-cell datasets…

PharMolix/OpenBioMed · 105 tokens

single-cell-scrna-seq-analysis-scanpy

Complete single-cell RNA-seq analysis workflow built on Scanpy and AnnData. Use this skill when: (1) Loading diverse single-cell data formats (10X, h5ad, CSV), (2) Performing quality control and filtering, (3) Normalization, dimensionality reduction, and clustering, (4) Marker gene identification and cell type…

PharMolix/OpenBioMed · 85 tokens

single-cell-multi-omics-analysis-scvi

Probabilistic deep learning framework for single-cell multi-omics data analysis. Use this skill when: (1) Analyzing single-cell RNA-seq data with batch correction, (2) Integrating multi-modal data (CITE-seq, ATAC-seq, multi-omics), (3) Performing cell type annotation with scANVI, (4) Spatial transcriptomics…

PharMolix/OpenBioMed · 94 tokens

anndata

Data structure for annotated matrices in single-cell analysis. Use when working with .h5ad files or integrating with the scverse ecosystem. This is the data format skill—for analysis workflows use scanpy; for probabilistic models use scvi-tools; for population-scale queries use cellxgene-census.

synthetic-sciences/openscience · 63 tokens

celltypepilot

Single-cell cell-type annotation with evidence, conservative abstention, and reviewable drafts. Use this whenever the user wants to annotate, label, or identify cell types for pre-clustered single-cell or spatial transcriptomics data (.h5ad), or says things like "annotate my clusters", "what cell types are these?"…

HERRY423/CellTypePilot · 151 tokens