Getting it into your agent
One page per mod, every tool's command on it. A separate URL per tool would split the same page into five that compete with each other.
npx skills add TianGzlab/OmicsClaw --skill pcr-primer-designgit clone --depth 1 https://github.com/TianGzlab/OmicsClawWrote this? Show the measurements
A badge with what this costs and how it scanned, read live from this page, so it follows the numbers instead of freezing them. Markdown for a README, HTML for a documentation site or a project page.
[](https://agentmods.dev/skills/tiangzlab/omicsclaw/pcr-primer-design)<a href="https://agentmods.dev/skills/tiangzlab/omicsclaw/pcr-primer-design"><img src="https://agentmods.dev/badge/skills/tiangzlab/omicsclaw/pcr-primer-design/github.svg" alt="Measured on agentmods" height="20"></a>Or the 80×15 button, for a site that already has a row of RSS and ATOM ones. Only the verdict fits; the numbers stay here.
<a href="https://agentmods.dev/skills/tiangzlab/omicsclaw/pcr-primer-design"><img src="https://agentmods.dev/badge/skills/tiangzlab/omicsclaw/pcr-primer-design.svg" alt="Reviewed on agentmods" width="80" height="20"></a>What it costs to keep this loaded
Counted locally with the o200k_base tokenizer, which is exact for GPT models; Claude uses its own tokenizer and its counts differ. Treat this as one consistent yardstick across the catalogue rather than a bill. Prices are per million input tokens.
| Model | Per session | Once invoked |
|---|---|---|
| Fable 5.1 | $0.00003 | $0.04486 |
| Opus 5 | $0.00002 | $0.02243 |
| Sonnet 5 | $0.00001 | $0.00897 |
| Haiku 4.5 | $0.00000 | $0.00449 |
Grade C, and why
PCR Primer Design scanned grade C with 1 finding against 26 rules in 11 categories — prompt injection, anti-refusal, data exfiltration, privilege escalation, supply chain, agent snooping, system-prompt leakage, SSRF and excessive agency — measured 10d ago.
A static scan of the body, not an audit. Every finding is printed with the line that produced it so you can judge whether it matters here. A mod is markdown that instructs an agent; that is exactly why what it instructs is worth reading.
Encoded or obfuscated payloadhighSupply chain
base64 or hex that is decoded and executed hides what actually runs from anyone reading the file.
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCA How it starts
The opening of the file, as written. The whole thing — 403 lines — stays where its author put it; the contents beside it link to each section on GitHub.
PCR Primer Design
Comprehensive PCR and qPCR primer design following MIQE 2.0 guidelines with automated validation.
When to Use This Skill
Use this skill when you need:
- ✅ qPCR primers with MIQE 2.0 compliance for publication
- ✅ Standard PCR primers for cloning, genotyping, or amplification (100-1000 bp)
- ✅ TaqMan probes for probe-based qPCR assays
- ✅ Rigorous validation (specificity, dimers, secondary structures)
- ✅ Publication-quality documentation with comprehensive reports
Choose application based on:
- qPCR: 70-140 bp amplicons, strict Tm matching (±2°C), MIQE compliance
- Standard PCR: 100-1000 bp amplicons, general amplification
- TaqMan: Probe-based detection, fluorescent assays
- Multiplex: Multiple targets, compatible Tm requirements
- Sequencing: Single-direction primers, Sanger sequencing
Don't use for:
- ❌ In-situ hybridization probes → use specialized oligo design tools
- ❌ NGS library prep primers → use adapter design workflows
- ❌ CRISPR guide RNAs → use CRISPR-specific design tools
Quick Start (Example)
Test this skill with a sample qPCR design in ~2 minutes:
# Example: Design qPCR primers for a 700bp target sequence
from design_qpcr_primers import design_qpcr_primers
# Sample GAPDH sequence (700 bp, exon 3-4 region)
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGCTCTCTCTTCCTCTTGTGCTCTTGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACG"
primers = design_qpcr_primers(
sequence=sequence,
amplicon_size_range=(80, 120),
num_return=5
)
print(f"Found {len(primers['primers'])} primer pairs")
print(f"MIQE-compliant: {sum(p.get('miqe_compliant', False) for p in primers['primers'])}")
What ships with it
16 files beside SKILL.md in the same directory: the scripts, references and assets a skill reads on demand. Not counted in the per-session cost; read them before you install if any of them is executable.
- references/code_examples.md 14 KB
- references/miqe_guidelines.md 11 KB
- references/parameter_ranges.md 9.6 KB
- references/primer_design_best_practices.md 12 KB
- references/troubleshooting_guide.md 14 KB
- scripts/__init__.py 147 B runs code
- scripts/calculate_tm.py 9.5 KB runs code
- scripts/check_dimers.py 9.1 KB runs code
- scripts/check_secondary_structures.py 9.8 KB runs code
- scripts/design_qpcr_primers.py 8.1 KB runs code
- scripts/design_standard_primers.py 6.5 KB runs code
- scripts/design_taqman_probes.py 7.5 KB runs code
- scripts/export_results.py 12 KB runs code
- scripts/generate_reports.py 13 KB runs code
- scripts/validate_specificity.py 9.1 KB runs code
- scripts/visualize_primers.py 10 KB runs code
What this file has done since we first saw it
Hashed on every crawl. A supply-chain change to an agent config is a question of when, not whether, so the history is kept rather than the latest state alone.
- 10d ago First seen · 403 lines · 3 tokens per session scan C 668d101dfd51
PCR Primer Design is a skill published in the GitHub repository TianGzlab/OmicsClaw (160 stars, last pushed 1mo ago), licensed Apache-2.0. It adds 3 tokens to every session and 4,486 once invoked, about $0.0000 per session on Opus 5. A static security scan graded it C with 1 finding (encoded or obfuscated payload). No closer match exists in the catalogue, so it is treated as the original; first seen 2026-08-30.
Other skills, from other repositories
scanpy
Standard single-cell RNA-seq analysis pipeline. Use for QC, normalization, dimensionality reduction (PCA/UMAP/t-SNE), clustering, differential expression, and visualization. Best for exploratory scRNA-seq analysis with established workflows. For deep learning models use scvi-tools; for data format questions use…
cellxgene-census-query
Query CZ CELLxGENE Census (61M+ cells). Filter by cell type/tissue/disease, retrieve expression data, and integrate with scanpy/PyTorch for population-scale single-cell analysis. Use this skill when: (1) Querying single-cell expression data by cell type, tissue, or disease, (2) Exploring available single-cell datasets…
single-cell-scrna-seq-analysis-scanpy
Complete single-cell RNA-seq analysis workflow built on Scanpy and AnnData. Use this skill when: (1) Loading diverse single-cell data formats (10X, h5ad, CSV), (2) Performing quality control and filtering, (3) Normalization, dimensionality reduction, and clustering, (4) Marker gene identification and cell type…
single-cell-multi-omics-analysis-scvi
Probabilistic deep learning framework for single-cell multi-omics data analysis. Use this skill when: (1) Analyzing single-cell RNA-seq data with batch correction, (2) Integrating multi-modal data (CITE-seq, ATAC-seq, multi-omics), (3) Performing cell type annotation with scANVI, (4) Spatial transcriptomics…
anndata
Data structure for annotated matrices in single-cell analysis. Use when working with .h5ad files or integrating with the scverse ecosystem. This is the data format skill—for analysis workflows use scanpy; for probabilistic models use scvi-tools; for population-scale queries use cellxgene-census.
celltypepilot
Single-cell cell-type annotation with evidence, conservative abstention, and reviewable drafts. Use this whenever the user wants to annotate, label, or identify cell types for pre-clustered single-cell or spatial transcriptomics data (.h5ad), or says things like "annotate my clusters", "what cell types are these?"…